Review



atp chemicals, peptides, and recombinant proteins  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Thermo Fisher atp chemicals, peptides, and recombinant proteins
    Atp Chemicals, Peptides, And Recombinant Proteins, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/pbs+chemicals++peptides++and+recombinant+proteins/pm40393459-239-140-151
    Average 90 stars, based on 1 article reviews
    atp chemicals, peptides, and recombinant proteins - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Filtration:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Purification:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Plasmid Preparation:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Ligation:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Recombinant:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    cDNA Synthesis:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Construct:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Binding Assay:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Sequencing:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Incubation:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Fluorescence:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Labeling:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Concentration Assay:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Standard Deviation:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Translocation Assay:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Molecular Weight:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.

    Serial Dilution:

    Article Title: α-Synuclein orchestrates Th17 responses as antigen and adjuvant in Parkinson’s disease
    Article Snippet: Then, 1 g of PLK3 was added to 144 g of S and reacted at 30°C for 16 hours in the presence of 20 mM HEPES, 10 mM MgCl2 (Nippon Gene, Tokyo, Japan), 2 mM dithiothreitol (Fujifilm, Tokyo, Japan), and 1.09 mM ATP (ThermoFisher).

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium glutamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each of l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each of l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser and l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 20 mM creatine phosphate (Roche), 60 μg/ml creatine kinase (Roche), 4.65 μg/ml myokinase (Sigma), 0.48 μg/ml nucleoside diphosphate kinase (Sigma), 0.3 U/ml inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/ml total calf tRNA (Sigma), 0.8 U/μl RiboLock RNase Inhibitor (Thermo Fisher Scientific) and 1000 ng mRNA.

    Article Title: A humanized monoclonal antibody targeting an ectonucleotidase rescues cardiac metabolism and heart function after myocardial infarction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Von Kossa Stain Kit StatLab KTVKO Deposited data Single nucleus RNA sequencing This paper GEO: GSE225826 Experimental models: Cell lines HEK293T ATCC CRL-3216 Experimental models: Organisms/strains Mouse: Humanized ENPP1 mouse This paper NA Mouse: B6.Cg-Fcgrttm1Dcr Tg(FCGRT) 32Dcr/DcrJ The Jackson Laboratory 014565 Oligonucleotides Primers for cloning, see Table S7 in method details This paper N/A Primers for ECM genes, see Table S8 in method details This paper N/A Primer: Human ENPP1 specific Forward: ACCTGGATTCAAGCATGGCA This paper N/A Primer: Human ENPP1 specific Reverse: TGGGGTTTCTTGTGAAGGGG This paper N/A Primer: Mouse ENPP1 specific Forward: ACAGCTTAATCTGACCACAGAA This paper N/A Primer: human ENPP1 specific Reverse: TTTAGTCTCGGTGGCGTGAG This paper N/A Recombinant DNA Human ENPP1 Horizon Discovery MHS6278-202806113 Mouse ENPP1 Horizon Discovery OMM5895-202525461 Rat ENPP1 GenScript NM_053535.1 Pig ENPP1 GenScript XM_021087933.1 Monkey Universal Reference CDNA Zyagen KD-UR-40 pHIV-EGFP Addgene #21373 Human ENPP3 R&D Systems RDC2698 Human ENPP4 Horizon Discovery MHS6278-202806522 Human ENPP5 Horizon Discovery MHS6278-202807818 Human CD39 Horizon Discovery MHS6278-202802580 Human CD73 Horizon Discovery MHS6278-202759798 pIRES2-EGFP Clontech 6029–1 pAcGFP1-C1 Clontech 632470 Software and algorithms Molecular Operating Environment (MOE) Computing Group ULC 2022 ImageQuant software GE healthcare, Version 8.2 Amide software Sourceforge Version 1.0.6 ORS Dragonfly software Object research systems Version 2022.2 Prism GraphPad Version 9.0 OPEN ACCESS

    Article Title: RNA elements required for the high efficiency of West Nile Virus-induced ribosomal frameshifting
    Article Snippet: Briefly, for a 10 μL reaction, 5 μL of cell extract was used in a buffer containing final concentrations of 52 mM HEPES, pH 7.4 (Takara), 35 mM KGlu (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM spermidine (Sigma), 1.5% Glycerol (Thermo Fisher Scientific), 0.7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scientific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM GTP (Thermo Fisher Scientific), 100 μM L-Arg; 67 μM each of L-Gln, L-Ile, L-Leu, L-Lys, L-Thr, L-Val; 33 μM each of L-Ala, L-Asp, L-Asn, L-Glu, Gly, L-His, L-Phe, L-Pro, L-Ser, L-Tyr; 17 μM each of L-Cys, L-Met; 8 μM L-Trp, 20 mM creatine phosphate (Roche), 60 μg/mL creatine kinase (Roche), 4.65 μg/mL myokinase (Sigma), 0.48 μg/mL nucleosidediphosphate kinase (Sigma), 0.3 u/mL inorganic pyrophosphatase (Thermo Fisher Scientific), 100 μg/mL total calf tRNA (Sigma), 0.8 u/μL RiboLock RNase Inhibitor (Thermo Fisher Scientific), and 1000 ng mRNA.

    Article Title: RNA elements required for the high efficiency of West Nile virus-induced ribosomal frameshifting.
    Article Snippet: Briefly, for a 10 μl reaction, 5 μl of cell xtract was used in a buffer containing final concentrations f 52 mM HEPES, pH 7.4 (Takara), 35 mM potassium gluamate (Sigma), 1.75 mM Mg(OAc) 2 (Invitrogen), 0.55 mM permidine (Sigma), 1.5% glycerol (Thermo Fisher Scientific), .7 mM putrescine (Sigma), 5 mM DTT (Thermo Fisher Scintific), 1.25 mM ATP (Thermo Fisher Scientific), 0.12 mM TP (Thermo Fisher Scientific), 100 μM l -Arg, 67 μM each f l -Gln, l -Ile, l -Leu, l -Lys, l -Thr and l -Val, 33 μM each f l -Ala, l -Asp, l -Asn, l -Glu, Gly, l -His, l -Phe, l -Pro, l -Ser nd l -Tyr, 17 μM each of l -Cys and l -Met, 8 μM l -Trp, 0 mM creatine phosphate (Roche), 60 μg / ml creatine kiase (Roche), 4.65 μg / ml myokinase (Sigma), 0.48 μg / ml nuleoside diphosphate kinase (Sigma), 0.3 U / ml inorganic pyophosphatase (Thermo Fisher Scientific), 100 μg / ml total calf RNA (Sigma), 0.8 U / μl RiboLock RNase Inhibitor (Thermo isher Scientific) and 1000 ng mRNA.

    Article Title: MTS, WST-8, and ATP viability assays in 2D and 3D cultures: Comparison of methodologically different assays in primary human chondrocytes
    Article Snippet: For the 2D standard curve a serial dilution of ATP (ThermoFisher, Waltham, USA) in medium with a starting concentration of 4 μM was mixed with CellTiter-Glo 2.0 reagent for 2 min and further incubated for 10 min according to manufacturers’ instructions.

    Article Title: Single turnover transient state kinetics reveals processive protein unfolding catalyzed by Escherichia coli ClpB
    Article Snippet: ATP and ATPγS were purchased from Thermo Fisher Scientific (Waltham, MA) and CalBiochem (La Jolla, CA), respectively.

    Article Title: Investigating Pseudomonas aeruginosa Gene Function During Pathogenesis using Mobile-CRISPRi
    Article Snippet: BsaI-HF-v2 restriction enzyme and 10X Cutsmart buffer (New England Biolabs R3733) T4 DNA ligase (e.g., New England Biolabs M0202) 1 mM ATP (e.g., Thermo R0441, diluted 100X) 100 mM DL-dithiothreitol (DTT, Sigma 9779): Dissolve 0.154 g DTT (MW 154.3) in a final volume of 10 ml dH 2 O, sterilize by filtration, and store 1 ml aliquots at −20°C.



    Similar Products

    atp chemicals, peptides, and recombinant proteins  (Thermo Fisher)
    90
    Thermo Fisher atp chemicals, peptides, and recombinant proteins
    Atp Chemicals, Peptides, And Recombinant Proteins, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/pbs+chemicals++peptides++and+recombinant+proteins/pm40393459-239-140-151
    Average 90 stars, based on 1 article reviews
    atp chemicals, peptides, and recombinant proteins - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    atp chemical  (Millipore)
    90
    Millipore atp chemical
    Atp Chemical, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/atp+chemical/pm40631926-890-11-12
    Average 90 stars, based on 1 article reviews
    atp chemical - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    atp chemical  (Sangon Biotech)
    90
    Sangon Biotech atp chemical
    Atp Chemical, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/atp+chemical/pm40595590-451-14-22
    Average 90 stars, based on 1 article reviews
    atp chemical - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    atp chemical  (Cell Signaling Technology Inc)
    90
    Cell Signaling Technology Inc atp chemical
    Atp Chemical, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/atp+chemical/pm40397754-367-15-16
    Average 90 stars, based on 1 article reviews
    atp chemical - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    atp chemical  (FUJIFILM)
    90
    FUJIFILM atp chemical
    Atp Chemical, supplied by FUJIFILM, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/atp/pm40184792-44-2-11
    Average 90 stars, based on 1 article reviews
    atp chemical - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    atp assay kit (cayman chemical)  (Cayman Chemical)
    90
    Cayman Chemical atp assay kit (cayman chemical)
    Atp Assay Kit (Cayman Chemical), supplied by Cayman Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/atp+assay+kit/pm40065099-399-7-10
    Average 90 stars, based on 1 article reviews
    atp assay kit (cayman chemical) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    atp chemical  (Thermo Fisher)
    90
    Thermo Fisher atp chemical
    Atp Chemical, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/atp+chemical/pmc11890080-110-21-23
    Average 90 stars, based on 1 article reviews
    atp chemical - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    chemical compound, drug atp  (Merck KGaA)
    90
    Merck KGaA chemical compound, drug atp

    Chemical Compound, Drug Atp, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atp+chemical/atp+chemical/pmc11856931-58-4-6
    Average 90 stars, based on 1 article reviews
    chemical compound, drug atp - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: A VgrG2b fragment cleaved by caspase-11/4 promotes Pseudomonas aeruginosa infection through suppressing the NLRP3 inflammasome

    doi: 10.7554/eLife.99939

    Figure Lengend Snippet:

    Article Snippet: Chemical compound, drug , ATP , Merck Millipore , Cat# A6559 , .

    Techniques: Sequencing, RNA Extraction, Cell Viability Assay, Cytotoxicity Assay, Software